Review



qiime pipeline  (Thermo Fisher)


Bioz Verified Symbol Thermo Fisher is a verified supplier
Bioz Manufacturer Symbol Thermo Fisher manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 90

    Structured Review

    Thermo Fisher qiime pipeline
    Qiime Pipeline, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/pm36933213-275-57-51
    Average 90 stars, based on 1 article reviews
    qiime pipeline - by Bioz Stars, 2026-09
    90/100 stars

    Images

    Related Articles

    Concentration Assay:

    Article Title: ILC3s restrict the dissemination of intestinal bacteria to safeguard liver regeneration after surgery.
    Article Snippet: Concentrations of purified DNA were measured using Qubit (Thermo Fisher Scientific). .. DNA was pooled at a concentration of 26pM and was sequenced for the V5/V6 region of 16S rRNA genes using a multiplex approach with the barcoded forward fusion primer 50- CCATCTCATCCCTGCGTGTCTCCGACTCAG BARCODE ATTAGATACCCYGGTAGTCC-30 in combination with the reverse fusion primer 50-CCTCTCTATGGGCAGTCGGTGATACG AGCTGACGACARCCATG-30, in IonTorrent PGM system according to the manufacturer’s instructions (ThermoFisher).79,80 Data was further analyzed using QIIME pipeline after filtering out low quality (accuracy of base calling; q < 25) samples. .. Operational taxonomic units (OTUs) were picked using UCLUST with a 97% sequence identity threshold followed by taxonomy assignment using the latest GreenGenes database (http://greengenes.secondgenome.com/).

    Multiplex Assay:

    Article Title: ILC3s restrict the dissemination of intestinal bacteria to safeguard liver regeneration after surgery.
    Article Snippet: Concentrations of purified DNA were measured using Qubit (Thermo Fisher Scientific). .. DNA was pooled at a concentration of 26pM and was sequenced for the V5/V6 region of 16S rRNA genes using a multiplex approach with the barcoded forward fusion primer 50- CCATCTCATCCCTGCGTGTCTCCGACTCAG BARCODE ATTAGATACCCYGGTAGTCC-30 in combination with the reverse fusion primer 50-CCTCTCTATGGGCAGTCGGTGATACG AGCTGACGACARCCATG-30, in IonTorrent PGM system according to the manufacturer’s instructions (ThermoFisher).79,80 Data was further analyzed using QIIME pipeline after filtering out low quality (accuracy of base calling; q < 25) samples. .. Operational taxonomic units (OTUs) were picked using UCLUST with a 97% sequence identity threshold followed by taxonomy assignment using the latest GreenGenes database (http://greengenes.secondgenome.com/).



    Similar Products

    90
    Thermo Fisher qiime pipeline
    Qiime Pipeline, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/pm36933213-275-57-51
    Average 90 stars, based on 1 article reviews
    qiime pipeline - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    86
    Novogene bioinformatics pipeline qiime
    Bioinformatics Pipeline Qiime, supplied by Novogene, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/bioinformatics+pipeline+standard/pmc12569786-117-8-5
    Average 86 stars, based on 1 article reviews
    bioinformatics pipeline qiime - by Bioz Stars, 2026-09
    86/100 stars
      Buy from Supplier

    90
    Novogene qiime pipeline software
    Qiime Pipeline Software, supplied by Novogene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+software/pmc11200607-176-9-4
    Average 90 stars, based on 1 article reviews
    qiime pipeline software - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc qiime v.1.91 pipeline
    Qiime V.1.91 Pipeline, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+v+1+91+pipeline/pm38200417-83-7-1
    Average 90 stars, based on 1 article reviews
    qiime v.1.91 pipeline - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Allwegene Technology Inc qiime version 1.8.0 software pipeline
    Qiime Version 1.8.0 Software Pipeline, supplied by Allwegene Technology Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+pipeline+tools/10__1002_slash_cche__10743-49-7-17
    Average 90 stars, based on 1 article reviews
    qiime version 1.8.0 software pipeline - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc qiime pipeline v1.9.1
    Qiime Pipeline V1.9.1, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+1+9+1/10__1016_slash_j__apsoil__2023__104915-144-6-13
    Average 90 stars, based on 1 article reviews
    qiime pipeline v1.9.1 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Pyrosequencing Inc quantitative into microbial ecology (qiime v1.9.1) pipeline
    Quantitative Into Microbial Ecology (Qiime V1.9.1) Pipeline, supplied by Pyrosequencing Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/quantitative+into+microbial+ecology++qiime+v1+9+1++pipeline/pm37163892-92-8-0
    Average 90 stars, based on 1 article reviews
    quantitative into microbial ecology (qiime v1.9.1) pipeline - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc qiime 2 pipeline version 2020.2
    Qiime 2 Pipeline Version 2020.2, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+2+pipeline+version+2020+2/pm36478318-69-8-1
    Average 90 stars, based on 1 article reviews
    qiime 2 pipeline version 2020.2 - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    90
    Illumina Inc qiime pipeline
    Qiime Pipeline, supplied by Illumina Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/qiime+pipeline/qiime+pipeline/pm36577329-200-16-20
    Average 90 stars, based on 1 article reviews
    qiime pipeline - by Bioz Stars, 2026-09
    90/100 stars
      Buy from Supplier

    Image Search Results