qiime pipeline (Thermo Fisher)
Thermo Fisher is a verified supplier 
Thermo Fisher manufactures this product 
90
Structured Review
Thermo Fisher
qiime pipeline
Qiime Pipeline, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/qiime+pipeline/pm36933213-275-57-51
Average 90 stars, based on 1 article reviews
Qiime Pipeline, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/qiime+pipeline/pm36933213-275-57-51
Average 90 stars, based on 1 article reviews
qiime pipeline - by Bioz Stars,
2026-09
90/100 stars
Images
Related Articles
Concentration Assay:Article Title: ILC3s restrict the dissemination of intestinal bacteria to safeguard liver regeneration after surgery. Article Snippet: Concentrations of purified DNA were measured using Qubit (Thermo Fisher Scientific). .. DNA was pooled at a concentration of 26pM and was sequenced for the V5/V6 region of 16S rRNA genes using a multiplex approach with the barcoded forward fusion primer 50- CCATCTCATCCCTGCGTGTCTCCGACTCAG BARCODE ATTAGATACCCYGGTAGTCC-30 in combination with the reverse fusion primer 50-CCTCTCTATGGGCAGTCGGTGATACG AGCTGACGACARCCATG-30, in IonTorrent PGM system according to the manufacturer’s instructions (ThermoFisher).79,80 Data was further analyzed using Multiplex Assay:Article Title: ILC3s restrict the dissemination of intestinal bacteria to safeguard liver regeneration after surgery. Article Snippet: Concentrations of purified DNA were measured using Qubit (Thermo Fisher Scientific). .. DNA was pooled at a concentration of 26pM and was sequenced for the V5/V6 region of 16S rRNA genes using a multiplex approach with the barcoded forward fusion primer 50- CCATCTCATCCCTGCGTGTCTCCGACTCAG BARCODE ATTAGATACCCYGGTAGTCC-30 in combination with the reverse fusion primer 50-CCTCTCTATGGGCAGTCGGTGATACG AGCTGACGACARCCATG-30, in IonTorrent PGM system according to the manufacturer’s instructions (ThermoFisher).79,80 Data was further analyzed using |